|
MatheMUSEments
Data in Hiding
By Ivars Peterson
Muse, January 2001, p. 22.
When Viviana Risca was a high school student in
Port Washington, New York, she found a way to hide secret
messages among DNA molecules. Heaps of DNA strands sit
like microscopic spaghetti inside plant and animal cells.
They are a kind of secret code already, only the
secret message they normally carry is instructions for
making a living creature, such as a clam or a peacock.
How did Risca use DNA to send a message?
DNA is a big molecule that looks like a twisted ladder. The
rungs on the ladder are chemical units called bases. Working with
researchers at the Mount Sinai School of Medicine in New York City,
Risca created a single strand of DNA made up of a sequence of
bases corresponding to the letters of a message. She mixed this
message strand with many other, different DNA molecules.
The researchers then dripped a tiny amount of the
DNA onto a small dot printed on filter paper. They cut out the dot,
taped it over the period in a typed note, and mailed the letter.
The person who got the secret message had
to know three things to decode it. He had to know that
one of the periods in the letter was a phony. He had to know a special
marker DNA sequence that would allow him to chemically pick the
message strand out from all the other DNA strands. And he had to
know which series of bases corresponded to which letters of the
alphabet.
The letter's recipient lifted the DNA dot, ran
it through some chemical steps that picked out the right DNA
strand and read out its sequence of bases, and decoded the message
using Risca's key. Risca won the top prize in the 2000 Intel Science
Talent Search for this project.
When spies of the future want to pass secret
messages to one another, maybe they'll bone up on molecular biology.
Decoding a DNA Message
The information in a DNA molecule is in the
rungs of this ladderlike molecule. These are chemical units called bases,
and there are only four of them: adenine, thymine, guanine, and
cytosine—abbreviated A, T, G, and C. Normally, sets of three
bases specify part of a protein, the molecules that do most of the
work in a living creature. In Risca's code, however, sets of three bases
stood for letters of the alphabet. For example, she made the letter L by
adding the bases TGC to the message strand she was building.
Key to Risca's Code:
| A: CGA |
F: GGT |
K: AAG |
P: GTG |
U: CTG |
Z: CTT |
0: ACT |
5: AGA |
| B: CCA |
G: TTT |
L: TGC |
Q: AAC |
V: CCT |
_: ATA |
1: ACC |
6: TTA |
| C: GTT |
H: CGC |
M: TCC |
R: TCA |
W: CCG |
,: TCG |
2: TAG |
7: ACA |
| D: TTG |
I: ATG |
N: TCT |
S: ACG |
X: CTA |
.: GAT |
3: GAC |
8: AGG |
| E: GGC |
J: AGT |
O: GGA |
T: TTC |
Y: AAA |
:: GCT |
4: GAG |
9: GCG |
Try decoding Risca's secret message:
AGTCTGTCTGGCTTAATAATGTCTCCTCGAACGATGGGATCTGCTTC
TGGATCATCCCGATCTTTGAAA.
|
SNK RSS Feed 
